1 day ago - Translate

https://www.selleckchem.com/products/ml323.html
) making it difficult to correlate presence of the virus with specific symptoms. To confirm the presence of GRVFV, samples from cvs. Sangiovese (n = 45) and Pinot gris (n = 1) were tested by RT-PCR using custom designed primers SaF-215 (5'- TACAAGGTGAATTGCTCCACAC -3' and SaR-1027 (5'-TCATTGGCGATGCGTTCG-3' to amplify the 813 bp sequence covering partial replicase associated polyprotein region of the virus genome. Sanger sfour amplicons (MT782067-MT78207 showed identities from 86% (700 bp out of 813 bp) with an Australian isolate (MT084